Journal: Cell Death & Disease

Article Title: Type 3 inositol 1,4,5-trisphosphate receptor has antiapoptotic and proliferative role in cancer cells

doi: 10.1038/s41419-019-1433-4

Figure Lengend Snippet: IP 3 R3-knockout DLD1 cell line, DLD1/IP 3 R3_del, was established using the CRISPR/Cas9 gene editing method. The IP 3 R3 protein knockout in DLD1/IP 3 R3_del cells was confirmed by immunofluorescence ( a ) and also by Western blot analysis ( b ) using anti-IP 3 R3 antibody. Either DLD1, or DLD1/IP 3 R3_del cells were subcutaneously injected into the lower flank of the nude mice and growth of tumors was compared ( c ). After 12 days, tumors were extirpated ( c ) and relative volumes were significantly lower from DLD1/IP 3 R3_del cells compared to DLD1 cells ( d ). Western blot analysis revealed increased expression of the IP 3 R1 in tumors from DLD1/IP 3 R3_del cells compared to DLD1 cells ( e ), while no expression of the IP 3 R3 was observed in tumors induced by DLD1/IP 3 R3_del cells ( f ). Apoptosis was determined in tumor slices by TUNEL assay ( g ), and differenced in morphology are shown by hematoxylin/eosin staining (HaE; g , bottom). NC negative control. In graphs, results are displayed as mean ± SEM, n = 6. Statistical significance * p < 0.05, ** p < 0.001, and *** p < 0.0001

Article Snippet: The IP 3 R3 CRISPR guide RNA sequences (GTGCCCCATGAACCGCTACT and TACGAGCTCAGCGACAACGC) were designed by the laboratory of Feng Zhang at the Broad Institute in order to efficiently target the IP 3 R3 gene with minimal risk of off-target Cas9 binding elsewhere in the genome , .

Techniques: Knock-Out, CRISPR, Immunofluorescence, Western Blot, Injection, Expressing, TUNEL Assay, Staining, Negative Control

Journal: Cell Death & Disease

Article Title: Type 3 inositol 1,4,5-trisphosphate receptor has antiapoptotic and proliferative role in cancer cells

doi: 10.1038/s41419-019-1433-4

Figure Lengend Snippet: Apoptosis induction in DLD1 and DLD1/IP 3 R3_del cells after silencing of the IP 3 R1 and subsequent induction of apoptosis by AIK ( a ). Silencing of the IP 3 R1 decreased the basal apoptosis compared to cells treated with scrRNA in both, DLD1 and DLD1/IP 3 R3_del cells. After treatment with AIK, apoptosis was significantly higher in DLD1/IP 3 R3_del than in DLD1 cells. In DLD1 cells, we observed co-localization of IP 3 R1 and IP 3 R3 by proximity ligation assay ( b ). Scale bar represents 25 μm. Silencing of the IP 3 R1 and/or IP 3 R3 revealed a decrease in levels of cytosolic calcium in RCC4, A2780 and DLD1 cells ( c ). Interestingly, the increase in cytosolic calcium after AIK treatment was not as high as in cells treated with scrambled RNA ( c ). Double knockout of IP 3 R1/IP 3 R3 completely abolished apoptosis induction ( d ). Further, we compared apoptosis induction ( e ) in DLD1 and DLD1/IP 3 R3_del cells after 24 and 48 h hypoxia induced by DMOG. Depletion of the IP 3 R3 resulted in rapid increase of apoptosis both, in normoxia and hypoxia. On contrary to DLD1 cells, this increase was not dependent on duration of hypoxia ( e ) in DLD1/IP 3 R3_del cells, but the level of the apoptosis was higher in normoxic and 24 h hypoxia group compared to DLD1 cells. Scale bar represents 300 μm. Results are displayed as mean ± SEM, n = 3–6. Statistical significance * p < 0.05, ** p < 0.001, and *** p < 0.0001

Article Snippet: The IP 3 R3 CRISPR guide RNA sequences (GTGCCCCATGAACCGCTACT and TACGAGCTCAGCGACAACGC) were designed by the laboratory of Feng Zhang at the Broad Institute in order to efficiently target the IP 3 R3 gene with minimal risk of off-target Cas9 binding elsewhere in the genome , .

Techniques: Proximity Ligation Assay, Double Knockout

Journal: Research and Practice in Thrombosis and Haemostasis

Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells

doi: 10.1002/rth2.12242

Figure Lengend Snippet: Schematic overview of the CRISPR clone generation workflow. Guide RNA s ( gRNA s) were designed to target exon 1 of the VWF gene (Step 1) and cloned into a Lenti CRISPR V2 vector (Step 2). HEK 293T cells were transfected with a vector containing a VWF targeting gRNA ( gRNA ‐1 or gRNA ‐2) or the empty Lenti CRISPR vector as a control ( CTRL ) (Step2). Lentivirus was produced in endothelialcell growth medium 18, and medium was transferred to cord blood outgrowth endothelial cells (cb BOEC s) from a single donor for transduction either directly or after combining medium containing 2 gRNA s, sometimes combining virus containing 2 different gRNA s for increased targeting efficiency (Step 4). Transduced cells were selected by puromycin and single‐cell sorted using vascular endothelial (VE) ‐cadherin as an endothelial cell surface marker (Step 5). Medium of single‐cell clones was collected for an ELISA‐ mediated high‐throughput screen for von Willebrand factor (VWF) deficient clones. Putative knockout clones were expanded to multiple larger culture surfaces for western blot ( WB ) and sequencing analysis to confirm biallelic VWF knockout (Step 8), after which they were cryopreserved or used for functional assays

Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′.

Techniques: CRISPR, Clone Assay, Plasmid Preparation, Transfection, Control, Produced, Transduction, Virus, Marker, Enzyme-linked Immunosorbent Assay, High Throughput Screening Assay, Knock-Out, Western Blot, Sequencing, Functional Assay

Journal: Research and Practice in Thrombosis and Haemostasis

Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells

doi: 10.1002/rth2.12242

Figure Lengend Snippet: Screening and mutation analysis of VWF knockout clones. (A) Conditioned medium of single‐cell clones that had reached >50% confluence was collected, and an ELISA for (secreted) von Willebrand factor (VWF) was performed as a first screen for VWF‐ deficient clones. Arrows indicate control ( CTRL ) and gRNA targeted clones that were selected for further screening. (B) After selected clones had been expanded to 6‐well plates and reached confluence, cells were lysed and VWF deficiency was assayed using immunoblotting with polyclonal anti‐ VWF and anti‐β‐actin as a loading control. Two control clones ( CTRL A and CTRL B) and two VWF −/− clones ( VWF −/− A and VWF −/− B) were selected, as indicated by the arrows. (C) Sanger sequencing and next‐generation sequencing on exon 1 of VWF were used to identify CRISPR /Cas9‐induced mutations. Sanger sequence traces are shown for all clones, and major mutations in both VWF −/− clones are indicated in the figure

Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′.

Techniques: Mutagenesis, Knock-Out, Clone Assay, Enzyme-linked Immunosorbent Assay, Control, Western Blot, Sequencing, Next-Generation Sequencing, CRISPR

Journal: Investigative Ophthalmology & Visual Science

Article Title: Mechanical Strain of Corneal Epithelium Influences the Expression of Genes Implicated in Keratoconus

doi: 10.1167/iovs.66.1.52

Figure Lengend Snippet: WNT10A regulates collagen XII production and TGFB1 pathway in corneal epithelial cells. Cas9-expressing hTCepi cells were transduced with a lentivirus coding for two individual WNT10A guide RNA sequences and compared to Cas9 cells transduced with a nontargeting sequence. Cell lysates were analyzed for transcript and protein levels of WNT10A, collagen XII, and collagen I (panels A and B , respectively). Transcript levels for MMP9 as a marker of keratoconus, and AXIN2 as a marker of Wnt pathway activation were also measured (panel A ). In order to evaluate the TGFβ pathway, mRNA, and protein levels of TGFβ1 (panels C and D , respectively) and mRNA levels of SMAD3 (panel C ) were measured. Comparisons were done in three lentiviral transduced clones against three scramble controls ( N = 6). * Indicates statistical significance ( P < 0.05).

Article Snippet: Using a lentivirus coding for a scramble guide RNA sequence, VB230207-1345jsw (see ; VectorBuilder, Chicago, IL, USA), we transduced the Cas9-expressing human corneal epithelial cells to create a control population.

Techniques: Expressing, Transduction, Sequencing, Marker, Activation Assay, Clone Assay

Journal: Investigative Ophthalmology & Visual Science

Article Title: Mechanical Strain of Corneal Epithelium Influences the Expression of Genes Implicated in Keratoconus

doi: 10.1167/iovs.66.1.52

Figure Lengend Snippet: WNT10A overexpression results in increase in TGFB1 mRNA expression. ( A ) Schematic of co-culture experiment, with WNT10A-overexpressing hTCepi cells in the upper chamber and primary activated fibroblasts in the lower chamber. WB demonstrates WNT10A overexpression (O/E) in epithelial cells transduced with a lentivirus coding for a WNT10A overexpression plasmid. The qPCR shows increased TGFB1 transcript levels in fibroblasts grown in co-culture with WNT10A overexpressing corneal epithelial cells. ( B ) Increased TGFB1 mRNA expression in two primary fibroblast cell lines sourced from different biological donors treated with 1 ng/mL of recombinant WNT10A. * Indicates statistical significance ( P < 0.05).

Article Snippet: Using a lentivirus coding for a scramble guide RNA sequence, VB230207-1345jsw (see ; VectorBuilder, Chicago, IL, USA), we transduced the Cas9-expressing human corneal epithelial cells to create a control population.

Techniques: Over Expression, Expressing, Co-Culture Assay, Transduction, Plasmid Preparation, Recombinant

Journal: bioRxiv

Article Title: Ras-dependent activation of BMAL2 regulates hypoxic metabolism in pancreatic cancer

doi: 10.1101/2023.03.19.533333

Figure Lengend Snippet: ( A ) Oxygen tension (y-axis) as determined by an OxyLite probe in tumors from KPC mice breathing ambient air or pure oxygen (x-axis). Dark blue circles represent averages per tumor and boxplots illustrate their distribution. Light blue circles represent repeat measurments per tumor. ( B ) HIF target genes (orange) controlled directly or indirectly by BMAL2 (yellow). Indirect control involves both BMAL2’s negative influence on first (dark blue) or second tier (light blue) RP repressing HIF target genes, and positive influence on first (dark red) and second (light red) tier RP activating HIF target genes. ( C ) Fold change in cell growth relative to cells expressing non-targeting sgRNA in normoxic (21% O2) and hypoxic (1% O2) conditions ( D ) Number of migrated cells for cells expressing non-targeting or BMAL2-directed sgRNA in the indicated oxygen environment. P-values are derived from testing the indicated coefficients from a linear regression model. Significant interaction term suggests synergistic effects of BMAL2 pertubation and hypoxia on cell migration. ( E ) Media pH levels after 72 hours incubation. P-values derived from Welch’s t-test ( F ) Fold change in lactate levels in the indicated oxygen environment expressing either non-targeting or BMAL2-directed sgRNA ( G ) Western Blot for HIF1a, HIF2a,

Article Snippet: The sgRNA (small-guide RNA) to knocking-out BMAL2 as well as non-targeting (NT) sequence were purchased from GenScript (Piscataway, NJ) using pLentiGuide-Puro vector as a backbone.

Techniques: Control, Expressing, Derivative Assay, Migration, Incubation, Western Blot